Experiment information
Accession CRX072977
Organism Fungi
Title N40-f1
BioProject PRJCA001919
BioSample SAMC114573
Platform Illumina HiSeq 2500
Library
Library name Construction protocol Strategy Source Selection Layout
The DNA of sludge samples were extracted. Primers GTGARTCATCGARTCTTTG (gITS7) and TCCTCCGCTTATTGATATGC (ITS4-R) were used for ITS region amplification. AMPLICON METAGENOMIC PCR PAIRED
Processing Planned read length (bp) for mate 1: 250
Planned read length (bp) for mate 2: 250
Insert size (bp): 300
Release date2019-11-18
Run
Run accession Release date Run data file information
File nameFile size (MB)
CRR085754 2019-11-18 N1.40.f-R1.fq.gz
N1.40.f-R2.fq.gz
7.94
7.56
SubmitterQiao Ma (xiaoma0556@qq.com)
OrganizationsDalian Maritime University
Date submitted2019-11-17